Table 1 Primer sequences for microglia and astrocyte cell markers and M1 or M2 activation markers
From: Preventive immunization of aged and juvenile non-human primates to beta-amyloid
Gene | NCBI reference sequence | Forward primer | Reverse primer |
|---|---|---|---|
Iba-1 | NM_001047118.1 | ccagggatttacagggagga | atcgccgtttccattaaggt |
CD68 | XM_001110126 | cagcacagtggacattctcg | tgatgagaggcagcaagatg |
GFAP | XM_001102095.2 | aagctccaggatgaaaccaa | aacctcctcctcgtggatct |
CXCL9 | NM_001032936.1 | taatgaggaagggtcgctgt | tttggctgacctgtttttcc |
CXCL10 | NM_001032892.1 | ttgctgccttgtctttctga | tgatggccttagattctgga |
IDO | NM_001077483.1 | ccgtcaagtgtttcagcaaa | caggacgtcaaagcactgaa |
CCR7 | NM_001032884 | gtggtggctctccttgtcat | gtaggcccacgaaacaaatg |
PTGS2 | XM_001107538.2 | cccttgggtgtgaaaggtaa | gccctcgcttatgatctgtc |
MRC1 | NM_001193925 | aaggaaaccatggacaatgc | ccatccatccaagcaaactt |
CCL17 | NM_001032852.1 | cttctctgcagcacatccat | aacagatggccttgttctgg |
GAPDH | NM_001195426 | tggaaggactcatgaccaca | ttcagctcagggatgacctt |